NEST2021BiologyMolecular Basis of Inheritance
A double-stranded DNA template with sequence 5'GCCATGAACTAGCTTCGATCGATGCTTGCCTACGTCAGTC3' was PCR-amplified using forward (5'GAACTA3') and reverse (5'ACGTAG3') primers. Given the size and sequence of the new PCR fragment produced (Table), the correct combination from the options is array |l|l| DNA fragment length & DNA fragment sequence (i) 30 & (k) 5'GAACTAGCTTCGATCGATGCTTGCCTACGT3' (ii) 18 & (l) 5'GCTTCGATCGATGCTTG
Options
- Aiv and 1
- Biii and m
- Cii and n
- Di and k
Correct answer
D. i and k
Step-by-step solution
No solution available.