Quantrex Quantrex AcademyJEE · NEET · NDA PYQs with solutions Open app
NEST2019BiologyMolecular Basis of Inheritance

Following is the sequence of a gene that produces peptide ' P ' and has a promoter sequence in the 5' upstream region of the sense strand and not in that of the complementary strand. Sense strand - 5' ATGCCCTGCACTGCAGGGCAT 3' Complementary strand - 3' TACGGGACGTCACGTCCCGTA 5' If Adenine is replaced with Thymine, and Guanine is replaced with Cytosine and vice-versa in both the DNA strands, then

Options

  1. AChargaff's rule will not hold true in this case.
  2. BThe reading frame of the sequence is completely altered.
  3. CChargaff's rule will hold true in this case.
  4. DTranscribing complementary strand from 3^ to 5^ will not give the peptide ' P '.

Correct answer

D. Transcribing complementary strand from 3^ to 5^ will not give the peptide ' P '.

Step-by-step solution

No solution available.

Practice Molecular Basis of Inheritance on Quantrex Academy →

More from Molecular Basis of Inheritance

Which of the following schematics correctly depict a lac operon that can be negatively regulated? 2026Which one of the following is the correct sequence of the coding strand of the given gene? 2026Who amongst the following scientist/s had no contribution in the development of the double-helix model for the structure of DNA? 2026In a DNA molecule, cytosine is 28 % . Calculate the percentage of adenine. 2026Arrange the below given steps of DNA fingerprinting in sequence by selecting the appropriate option. a) Digestion of DNA by restriction endonucleases b) Autoradiography c) Blotting 2026In an experiment, bacteria were grown for 500 generations in a medium containing ¹⁴ N (light isotope), then transferred to a medium with ¹⁵ N (heavy isotope) for one generation, an 2026Which amino acid will be charged on the tRNA with anticodon 5^ -GUU- 3^ ? 2025In the lac-operon system, lactose acts as an inducer that binds to the repressor protein attached to the operator region (lacO) and allows the expression of -galactosidase. When X- 2025 Full Molecular Basis of Inheritance list All NEST PYQs