NEST2019BiologyMolecular Basis of Inheritance
Following is the sequence of a gene that produces peptide ' P ' and has a promoter sequence in the 5' upstream region of the sense strand and not in that of the complementary strand. Sense strand - 5' ATGCCCTGCACTGCAGGGCAT 3' Complementary strand - 3' TACGGGACGTCACGTCCCGTA 5' If Adenine is replaced with Thymine, and Guanine is replaced with Cytosine and vice-versa in both the DNA strands, then
Options
- AChargaff's rule will not hold true in this case.
- BThe reading frame of the sequence is completely altered.
- CChargaff's rule will hold true in this case.
- DTranscribing complementary strand from 3^ to 5^ will not give the peptide ' P '.
Correct answer
D. Transcribing complementary strand from 3^ to 5^ will not give the peptide ' P '.
Step-by-step solution
No solution available.