Quantrex Quantrex AcademyJEE · NEET · NDA PYQs with solutions Open app
NEST2025BiologyMolecular Basis of Inheritance

Shotgun method was used for sequencing a stretch of DNA wherein the molecule was broken into small fragments and each fragment was sequenced. The DNA sequence was then assembled by identifying the overlaps. The 5'-3' sequence of the fragments ( I - V ) are given below: (I) GGCTCAAGGAGAGGG (II) CCGTCAAAAAAATTTAACCCTT (III) CCCTTAAGGAGAGAGGATTAGGA (IV) GGGAATTATACCGT (V) GGATACCTTTT Identify the alignment of the fragme

Options

  1. AI-IV-II-III-V
  2. BIII-I-II-IV-V
  3. CI-IV-V-II-III
  4. DIV-III-V-I-II

Correct answer

A. I-IV-II-III-V

Step-by-step solution

No Solution

Practice Molecular Basis of Inheritance on Quantrex Academy →

More from Molecular Basis of Inheritance

Which of the following schematics correctly depict a lac operon that can be negatively regulated? 2026Which one of the following is the correct sequence of the coding strand of the given gene? 2026Who amongst the following scientist/s had no contribution in the development of the double-helix model for the structure of DNA? 2026In a DNA molecule, cytosine is 28 % . Calculate the percentage of adenine. 2026Arrange the below given steps of DNA fingerprinting in sequence by selecting the appropriate option. a) Digestion of DNA by restriction endonucleases b) Autoradiography c) Blotting 2026In an experiment, bacteria were grown for 500 generations in a medium containing ¹⁴ N (light isotope), then transferred to a medium with ¹⁵ N (heavy isotope) for one generation, an 2026Which amino acid will be charged on the tRNA with anticodon 5^ -GUU- 3^ ? 2025In the lac-operon system, lactose acts as an inducer that binds to the repressor protein attached to the operator region (lacO) and allows the expression of -galactosidase. When X- 2025 Full Molecular Basis of Inheritance list All NEST PYQs