NEST2021BiologyMolecular Basis of Inheritance
A linear double-stranded DNA was completely digested using either one or two restriction endonucleases ( C f r 10 I and BanII). The sequence of one of the strands is provided. The restriction site for Cfr10I is RCCGGY and for BanII is GRGCYC ( R is A or G and Y is T or C ). 5'TGGAGAGACCGGTAGCAGAGAGCTCCATTCCGGGCGCGCCGGCACCCTTAGGA3' Based on this information, the correct option is
Options
- ADigestion with both C fri0I and BanII will generate three fragments.
- BDigestion with both Cfr10I and BanII will generate four fragments.
- CDigestion with BanII will generate one fragment.
- DDigestion with Cfr10I will generate two fragments.
Correct answer
B. Digestion with both Cfr10I and BanII will generate four fragments.
Step-by-step solution
No solution available.