Quantrex Quantrex AcademyJEE · NEET · NDA PYQs with solutions Open app
NEST2021BiologyMolecular Basis of Inheritance

A linear double-stranded DNA was completely digested using either one or two restriction endonucleases ( C f r 10 I and BanII). The sequence of one of the strands is provided. The restriction site for Cfr10I is RCCGGY and for BanII is GRGCYC ( R is A or G and Y is T or C ). 5'TGGAGAGACCGGTAGCAGAGAGCTCCATTCCGGGCGCGCCGGCACCCTTAGGA3' Based on this information, the correct option is

Options

  1. ADigestion with both C fri0I and BanII will generate three fragments.
  2. BDigestion with both Cfr10I and BanII will generate four fragments.
  3. CDigestion with BanII will generate one fragment.
  4. DDigestion with Cfr10I will generate two fragments.

Correct answer

B. Digestion with both Cfr10I and BanII will generate four fragments.

Step-by-step solution

No solution available.

Practice Molecular Basis of Inheritance on Quantrex Academy →

More from Molecular Basis of Inheritance

Which of the following schematics correctly depict a lac operon that can be negatively regulated? 2026Which one of the following is the correct sequence of the coding strand of the given gene? 2026Who amongst the following scientist/s had no contribution in the development of the double-helix model for the structure of DNA? 2026In a DNA molecule, cytosine is 28 % . Calculate the percentage of adenine. 2026Arrange the below given steps of DNA fingerprinting in sequence by selecting the appropriate option. a) Digestion of DNA by restriction endonucleases b) Autoradiography c) Blotting 2026In an experiment, bacteria were grown for 500 generations in a medium containing ¹⁴ N (light isotope), then transferred to a medium with ¹⁵ N (heavy isotope) for one generation, an 2026Which amino acid will be charged on the tRNA with anticodon 5^ -GUU- 3^ ? 2025In the lac-operon system, lactose acts as an inducer that binds to the repressor protein attached to the operator region (lacO) and allows the expression of -galactosidase. When X- 2025 Full Molecular Basis of Inheritance list All NEST PYQs