Home · NEET PYQs · Zoology · Molecular Basis of Inheritance

NEET Molecular Basis of Inheritance PYQs with Solutions

910 previous year questions from Molecular Basis of Inheritance (NEET UG Zoology) with answers and solutions. Numbered list, year tags, and one-tap solutions — built for serious JEE / NEET practice.

910 questionsZoology2002–2026Answers + solutions

About Molecular Basis of Inheritance PYQs

Molecular Basis of Inheritance has 910 previous year questions in the Quantrex Academy NEET UG Zoology bank. The 220 questions in this list come from NEET (132), JIPMER (55) and AIIMS (33), spanning 2002 to 2026. Each question opens on its own page with the options, the correct answer and the worked solution where available.

NEET Molecular Basis of Inheritance PYQs with Solutions

About Molecular Basis of Inheritance PYQs

Questions by year (this list)

Molecular Basis of Inheritance questions with solutions

Which of the following statements about lac-operon is correct ?

Which of the following enzymes synthesizes precursor mRNA ?

Which of the following statements are correct with reference to a transcription unit ? A. A transcription unit in DNA is defined primarily by three regions : promoter, structural

Which of the following statements are correct with reference to packaging of DNA helix ? A. Histones are organized to form a unit of eight molecules called histone octamer. B.

Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction endonucleases. B. Hybridisation using a labelled VNTR

In the lac operon, the z gene codes for :

Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic

Match List I with List II: List - I List - II A. Alfred Hershey and Martha Chase (i) Streptococcus pneumoniae B. Euchromatin (ii) Densely packed and dark-stained C. Frederick

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of

Which factor is important for termination of transcription?

Histones are enriched with -

Which chromosome in the human genome has the highest number of genes?

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:

Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during

Match List-I with List-II: List-I List-II A. Histones I. Loosely packed chromatin B. Nucleosome II. Densely packed Chromatin C. Euchromatin III. Positively charged basic proteins

Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

The lactose present in the growth medium of bacteria is transported to the cell by the action of

Match List I with List II Choose the correct answer from the options given below:

Which of the following statement is correct regarding the process of replication in E.coli?

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5

Match List I with List II: List I List II A. RNA polymerase III I. snRNPs B. Termination of transcription II. Promotor C. Splicing of Exons III. Rho factor D. TATA box IV. SnRNAs

Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.

The last chromosome sequenced in Human Genome Project was :

Given below are two statements : Statement I: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Statement II : A

Which scientist conducted an experiment with ^ 32 P and ^ 35 ~S labelled phages for demonstrating that DNA is the genetic material?

Given below are two statements: Statement I: RNA being unstable, mutate at a faster rate. Statement II: RNA can directly code for synthesis of proteins, hence can easily express

With reference to Hershey and Chase experiments. Select the correct statements. (A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA. (B) Viruses

Which one of the following acts as an inducer for lac operon?

Expressed Sequence Tags (ESTs) refers to

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In

Unequivocal proof that DNA is the genetic material was first proposed by

The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Match List I with List II: List I List II A. Gene &#39;a&#39; I. Beta-galactosidase B. Gene &#39;y&#39; II. Transacetylase C. Gene &#39;i&#39; III. Permease D. Gene &#39;z&#39

Which of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5&#39; AUCGAUCGAUCGAUCGAUCGAUCGAUCG &#39;3

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of

In lac operon, z gene codes for :

Given below are two statements : Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5^ arrow 3^ Statement II : During replication of DNA, on one

Match List - I with List - II : Choose the correct answer from the options given below :

If DNA contained sulphur instead of phosphorus and proteins contained phosphorus instead of sulfur, what would have been the outcome of Hershey and Chase experiment?

If A and C make 30 \% and 20 \% of DNA, respectively, what will be the percentage composition of T and G ?

The process of translation of mRNA to proteins begins as soon as :

Read the following statements and choose the set of correct statements: (a) Euchromatin is loosely packed chromatin. (b) Heterochromatin is transcriptionally active. (c) Histone

DNA Polymorphism forms the basis of:

If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is

In an E. coli strain, i gene gets mutated, and its product cannot bind the inducer molecule. If the growth medium is provided with lactose, what will be the outcome?

If the length of a DNA molecule is 1 . 1 metres, what will be the approximate number of base pairs?

Ten E. coli cells with N 15 -dsDNA are incubated in medium containing N 14 nucleotide. After 60 minutes, how many E. coli cells will have DNA totally free from N 15 ?

Match List-I with List-II : \( List - I List - II (a) Bacteriophage φ × 174 (i) 48502 base pairs (b) Bacteriophage lambda (ii) 5386 nucleotides (c) Escherichia coli (iii) 3.3 ×

Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA ?

Complete the flow chart on central dogma.

Identify the correct statement.

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:

If Adenine makes 30 % of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

Which of the following RNAs is not required for the synthesis of protein?

Which is the &quot;Only enzyme&quot; that has &quot;Capability&quot; to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?

Which one of the following statements about histones is wrong?

Statement I: The codon &#39;AUG&#39; codes for methionine and phenylalanine. Statement II: &#39;AAA&#39; and &#39;AAG&#39; both codons code for the amino acid lysine. In the light

The term &#39;Nuclein&#39; for the genetic material was used by:

In the polynucleotide chain of DNA , a nitrogenous base is linked to the - OH of:

E. coli has only 4 . 6 × 10 ^ 6 base pairs and completes the process of replication within 18 minutes; then the average rate of polymerisation is approximately:

Which is the basis of genetic mapping of human genome as well as DNA fingerprinting?

Name the enzyme that facilitates opening of DNA helix during transcription.

Which of the following statements is correct?

The first phase of translation is

If the distance between two consecutive base pairs is 0 . 34nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6 . 6 × 10 ^ 9 bp bp, then

Who discovered DNA fingerprinting?

Which of the following switches off lac operon?

The group of codons which codes for alanine is

Assertion : In eukaryotes, both intron and exon are transcribed to form hnRNA. Reason : Splicing is required in prokaryotes.

Identify A, B and C.

Chromosome walking is

Match List I with List II: List I List II A. Gene 'a' I. Beta-galactosidase B. Gene 'y' II. Transacetylase C. Gene 'i' III. Permease D. Gene 'z&#39

Which of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG '3

Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?

Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light

The term 'Nuclein' for the genetic material was used by:

Match the following genes of the Lac operon with their respective products: Column-I Column-II (a) i gene (i) ß-galactosidase (b) z gene (ii) Permease (c) a gene (iii)