Quantrex Academy Quantrex AcademyPYQs with solutions · JEE · NEET · NDA

Home · NEET UG · Zoology · Molecular Basis of Inheritance

Molecular Basis of Inheritance — NEET UG Zoology PYQs

910 previous year questions from Molecular Basis of Inheritance with answers and solutions. Numbered list, year tags, and one-tap solutions — built for serious JEE / NEET practice.

910 questionsZoologySolutions on every page
1

Which of the following statements about lac-operon is correct ?

NEET 2026 Solution View → 2

Which of the following enzymes synthesizes precursor mRNA ?

NEET 2026 Solution View → 3

Which of the following statements are correct with reference to a transcription unit ? A. A transcription unit in DNA is defined primarily by three regions : promoter, structural g

NEET 2026 Solution View → 4

Which of the following statements are correct with reference to packaging of DNA helix ? A. Histones are organized to form a unit of eight molecules called histone octamer. B. Hist

NEET 2026 Solution View → 5

Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction endonucleases. B. Hybridisation using a labelled VNTR

NEET 2026 Solution View → 6

In the lac operon, the z gene codes for :

NEET 2026 Solution View → 7

Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic m

NEET 2025 Solution View → 8

Match List I with List II: array |l|l|l|l| & List - I & & List - II A . & Alfred Hershey and Martha Chase & (i) & Streptococcus pneumoniae B. & Euchromatin & (ii) & Densely packed

NEET 2025 Solution View → 9

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exon

NEET 2025 Solution View → 10

Which factor is important for termination of transcription?

NEET 2025 Solution View → 11

Histones are enriched with -

NEET 2025 Solution View → 12

Which chromosome in the human genome has the highest number of genes?

NEET 2025 Solution View → 13

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

NEET 2025 Solution View → 14

In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:

NEET 2024 Solution View → 15

Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during trans

NEET 2024 Solution View → 16

Match List-I with List-II: array |l|l|r|l| & List-I & & List-II A. & Histones & I. & Loosely packed chromatin B. & Nucleosome & II. & Densely packed Chromatin C. & Euchromatin & II

NEET 2024 Solution View → 17

Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose

NEET 2024 Solution View → 18

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

NEET 2024 Solution View → 19

The lactose present in the growth medium of bacteria is transported to the cell by the action of

NEET 2024 Solution View → 20

Match List I with List II Choose the correct answer from the options given below:

NEET 2024 Solution View → 21

Which of the following statement is correct regarding the process of replication in E.coli?

NEET 2024 Solution View → 22

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5

NEET 2024 Solution View → 23

Match List I with List II: array |l|l|r|l| & List I & & List II A. & RNA polymerase III & I. & snRNPs B. & array l Termination of transcription array & II. & Promotor C. & Splicing

NEET 2024 Solution View → 24

Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: A

NEET 2024 Solution View → 25

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.

NEET 2023 Solution View → 26

The last chromosome sequenced in Human Genome Project was :

NEET 2023 Solution View → 27

Given below are two statements : Statement I: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Statement II : A transcript

NEET 2023 Solution View → 28

Which scientist conducted an experiment with ³² P and ³⁵ ~S labelled phages for demonstrating that DNA is the genetic material?

NEET 2023 Solution View → 29

Given below are two statements: Statement I: RNA being unstable, mutate at a faster rate. Statement II: RNA can directly code for synthesis of proteins, hence can easily express th

NEET 2023 Solution View → 30

With reference to Hershey and Chase experiments. Select the correct statements. (A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA. (B) Viruses g

NEET 2023 Solution View → 31

Which one of the following acts as an inducer for lac operon?

NEET 2023 Solution View → 32

Expressed Sequence Tags (ESTs) refers to

NEET 2023 Solution View → 33

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In

NEET 2023 Solution View → 34

Unequivocal proof that DNA is the genetic material was first proposed by

NEET 2023 Solution View → 35

The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choo

NEET 2023 Solution View → 36

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

NEET 2023 Solution View → 37

Match List I with List II: List I List II A. Gene 'a' I. Beta-galactosidase B. Gene 'y' II. Transacetylase C. Gene 'i' III. Permease D. Gene 'z' IV.

NEET 2023 Solution View → 38

Which of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG '3

NEET 2023 Solution View → 39

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of t

NEET 2023 Solution View → 40

In lac operon, z gene codes for :

NEET 2022 Solution View → 41

Given below are two statements : Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5^ 3^ Statement II : During replication of DNA, on one strand

NEET 2022 Solution View → 42

Match List - I with List - II : Choose the correct answer from the options given below :

NEET 2022 Solution View → 43

If DNA contained sulphur instead of phosphorus and proteins contained phosphorus instead of sulfur, what would have been the outcome of Hershey and Chase experiment?

NEET 2022 Solution View → 44

If A and C make 30 % and 20 % of DNA, respectively, what will be the percentage composition of T and G ?

NEET 2022 Solution View → 45

The process of translation of mRNA to proteins begins as soon as :

NEET 2022 Solution View → 46

Read the following statements and choose the set of correct statements: (a) Euchromatin is loosely packed chromatin. (b) Heterochromatin is transcriptionally active. (c) Histone oc

NEET 2022 Solution View → 47

DNA Polymorphism forms the basis of:

NEET 2022 Solution View → 48

If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is

NEET 2022 Solution View → 49

In an E. coli strain, i gene gets mutated, and its product cannot bind the inducer molecule. If the growth medium is provided with lactose, what will be the outcome?

NEET 2022 Solution View → 50

If the length of a DNA molecule is 1 . 1 metres, what will be the approximate number of base pairs?

NEET 2022 Solution View → 51

Ten E. coli cells with N 15 -dsDNA are incubated in medium containing N 14 nucleotide. After 60 minutes, how many E. coli cells will have DNA totally free from N 15 ?

NEET 2022 Solution View → 52

Match List-I with List-II : ( array |l|l| List - I & List - II (a) Bacteriophage 174 & (i) 48502 base pairs (b) Bacteriophage lambda & (ii) 5386 nucleotides (c) Escherichia coli &

NEET 2022 Solution View → 53

Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA ?

NEET 2022 Solution View → 54

Complete the flow chart on central dogma.

NEET 2021 Solution View → 55

Identify the correct statement.

NEET 2021 Solution View → 56

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

NEET 2021 Solution View → 57

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:

NEET 2021 Solution View → 58

If Adenine makes 30 % of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

NEET 2021 Solution View → 59

Which of the following RNAs is not required for the synthesis of protein?

NEET 2021 Solution View → 60

Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?

NEET 2021 Solution View → 61

Which one of the following statements about histones is wrong?

NEET 2021 Solution View → 62

Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light

NEET 2021 Solution View → 63

The term 'Nuclein' for the genetic material was used by:

NEET 2020 Solution View → 64

In the polynucleotide chain of DNA , a nitrogenous base is linked to the - OH of:

NEET 2020 Solution View → 65

E. coli has only 4 . 6 × 10 6 base pairs and completes the process of replication within 18 minutes; then the average rate of polymerisation is approximately:

NEET 2020 Solution View → 66

Which is the basis of genetic mapping of human genome as well as DNA fingerprinting?

NEET 2020 Solution View → 67

Name the enzyme that facilitates opening of DNA helix during transcription.

NEET 2020 Solution View → 68

Which of the following statements is correct?

NEET 2020 Solution View → 69

The first phase of translation is

NEET 2020 Solution View → 70

If the distance between two consecutive base pairs is 0 . 34   nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6 . 6 × 10 9 bp

NEET 2020 Solution View → 71

Who discovered DNA fingerprinting?

AIIMS 2019 Solution View → 72

Which of the following switches off lac operon?

AIIMS 2019 Solution View → 73

The group of codons which codes for alanine is

AIIMS 2019 Solution View → 74

Assertion : In eukaryotes, both intron and exon are transcribed to form hnRNA. Reason : Splicing is required in prokaryotes.

AIIMS 2019 Solution View → 75

Identify A, B and C.

AIIMS 2019 Solution View → 76

Chromosome walking is

JIPMER 2019 Solution View → 77

RNA binds to tRNA through

JIPMER 2019 Solution View → 78

In DNA 20 % bases are adenine. What percentage of bases are pyrimidines?

JIPMER 2019 Solution View → 79

Which of the following is not a stop codon?

JIPMER 2019 Solution View → 80

During DNA replication, supercoilling is relaxed by

JIPMER 2019 Solution View → 81

Which of the following is not true?

JIPMER 2019 Solution View → 82

From the following, identify the correct combination of salient features of Genetic code.

NEET 2019 Solution View → 83

Match the following RNA polymerases with their transcribed products Select the correct option from the following

NEET 2019 Solution View → 84

"Ramachandran plot" is used to confirm the structure of

NEET 2019 Solution View → 85

Purines found both in DNA and RNA are

NEET 2019 Solution View → 86

Expressed sequence tags (ESTs) refers to:

NEET 2019 Solution View → 87

Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?

NEET 2019 Solution View → 88

Match the following genes of the Lac operon with their respective products: Column-I Column-II a   i gene   i ß-galactosidase b z gene i i Permease c a gene i i i R

NEET 2019 Solution View → 89

What will be the sequence of mRNA produced by the following stretch of DNA? 3'ATGCATGCATGCATG5' TEMPLATE STRAND 5'TACGTACGTACGTAC3' CODING STRAND

NEET 2019 Solution View → 90

Which scientist experimentally proved that DNA is the sole genetic material in bacteriophage?

NEET 2019 Solution View → 91

What initiation and termination factors are involved in transcription in eukaryotes?

NEET 2019 Solution View → 92

In the process of transcription in eukaryotes, the RNA polymerase I transcribes

NEET 2019 Solution View → 93

Under which of the following conditions will there be no change in the reading frame of the following mRNA? 5'AACAGCGGUGCUAUU 3'

NEET 2019 Solution View → 94

Assertion: Amber codon is a termination codon. Reason : If in m RNA, a termination codon is present, the protein synthesis stops abruptly whether the protein synthesis is completed

AIIMS 2018 Solution View → 95

Which of the following is a non-sense mutation?

AIIMS 2018 Solution View → 96

Find out the incorrect match.

AIIMS 2018 Solution View → 97

Codons of alanine are

AIIMS 2018 Solution View → 98

Which of the following statements is correct regarding eukaryotic translation?

AIIMS 2018 Solution View → 99

To which of the following, repressor protein is attached?

JIPMER 2018 Solution View → 100

Which of the following mRNA can be transcripted as

JIPMER 2018 Solution View → 101

Which is present at 5^ end of eukaryotic mRNA?

JIPMER 2018 Solution View → 102

Linker-DNA is attached to

JIPMER 2018 Solution View → 103

Select the correct match:

NEET 2018 Solution View → 104

The experimental proof for semiconservative replication of DNA was first shown in a

NEET 2018 Solution View → 105

All of the following are part of an operon except

NEET 2018 Solution View → 106

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?

NEET 2018 Solution View → 107

Select the correct match:

NEET 2018 Solution View → 108

Match the triplet codons listed in column I with their amino acids mentioned in column II and select the correct option from the given codes.

AIIMS 2017 Solution View → 109

Refer to the given figure and select the correct option regarding its parts labelled as A, B and C .

AIIMS 2017 Solution View → 110

Minisatellites or VNTR’s are used in

JIPMER 2017 Solution View → 111

hnRNA undergoes two additional process. Out of them in one process an unusual nucleotide (methyl GPT) is added to the 5 ' end of molecule. What would you called this?

JIPMER 2017 Solution View → 112

In the lac operon model, lactose molecules function as

JIPMER 2017 Solution View → 113

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many

NEET 2017 Solution View → 114

The association of histone H 1 with a nucleosome indicates:

NEET 2017 Solution View → 115

Which of the following statements is correct? a. rRNA is the most abundant RNA. b. Ribosomes are composed of approximately 80% rRNA and 20% ribosomal proteins. c. rRNA is a type of

NEET 2017 Solution View → 116

During DNA replication, Okazaki fragments are used to elongate:

NEET 2017 Solution View → 117

The final proof for DNA as the genetic material came from the experiments of

NEET 2017 Solution View → 118

Spliceosomes are not found in cells of:

NEET 2017 Solution View → 119

In a 3.2 Kbp long piece of DNA, 820 adenine bases were found. What would be the number of cytosine bases?

AIIMS 2016 Solution View → 120

If the sequence of bases in the coding strand of a double stranded DNA is 5'-GTTCGAGTC-3', the sequence of bases in its transcript will be

AIIMS 2016 Solution View →
Practice all Molecular Basis of Inheritance questions in the app →